0
Study |

A Search for CDKN2A/p16INK4a Mutations in Melanocytic Nevi From Patients With Melanoma and Spouse Controls by Use of Laser-Captured Microdissection FREE

Hao Wang, MD, PhD; Richard B. Presland, PhD; Michael Piepkorn, MD, PhD
[+] Author Affiliations

Author Affiliations: Department of Medicine, Division of Dermatology (Drs Wang, Presland, and Piepkorn), Department of Oral Biology (Dr Presland), and Department of Pathology (Dr Piepkorn), University of Washington, Seattle.


Arch Dermatol. 2005;141(2):177-180. doi:10.1001/archderm.141.2.177.
Text Size: A A A
Published online

Objective  To determine the frequency at which the CDKN2A coding region is mutated in the atypical nevi of persons with sporadic melanoma.

Design  DNA samples, isolated by laser-captured microdissection of atypical nevi from 10 patients with newly incident cases of sporadic melanoma and their spouses as matched controls, were used as templates for nested polymerase chain reaction amplification of CDKN2A exons 1 and 2.

Results  No point mutations in the coding region of CDKN2A were observed in any of the melanocytic nevi.

Conclusions  Point mutations in CDKN2A are an uncommon event in the atypical nevi of persons with melanoma. As such, the data may support a hypothesis of melanocytic nevus histogenesis, in which the melanocytic nevus and malignant melanoma represent separate, pleiotropic pathways resulting from common stimuli, such as genomic damage from UV radiation.

Figures in this Article

Conceptual models of melanoma development and progression incorporate common and atypical (dysplastic) nevi as potential stages in the evolution of the malignant phenotype in melanocytic systems.1 Support for this hypothesis can be found, among other lines of evidence, in the spatial coexistence of melanoma and nevi at both the clinical and histological levels and in the strong statistical correlation of increasing numbers and sizes of nevi with increasing relative risk for melanoma.2

A prediction of this widely held model system is that melanocytic nevi could share certain genetic alterations that are crucial to the initiation and/or evolution of malignant melanoma. The major melanoma gene thus far identified is CDKN2A, which is also known as p16INK4a. Point mutations or deletions at that 9p21 chromosomal locus are putatively initiating events in the transformation of melanocytic cells, and segregatingp16 germline mutations account for up to 40% of all cases of familial melanoma.2 At present, there is no consensus as to whether melanocytic nevi, atypical or otherwise, sustain similar genetic alterations at a frequency sufficient to reflect a function as a significant factor in melanoma progression. For example, p16 protein and messenger RNA are expressed at seemingly normal levels in atypical as well as banal nevi, but at significantly reduced levels in many melanomas, including the earliest recognizable stage, melanoma in situ.35 Moreover, the phenotype of multiple and/or enlarged nevi does not genetically segregate with, nor readily link by polymorphic markers to, the CDKN2A locus.6,7 In addition, chromosomal loss, point mutations, and promoter methylation vicinal to the CDKN2A locus were not found in melanocytic nevi,8 nor were homozygous deletions or point mutations observed in dysplastic nevi.9 On the other hand, others have presented evidence that in atypical nevi, as in melanoma, there may be point mutations10 and hemizygous or homozygous allelic deletions at or near CDKN2A.1114 Also, atypical nevi and melanoma express DNA mismatch repair genes at a lower level15 and have greater microsatellite instability at markers near CDKN2A than do common nevi.16

In the present study, we isolated the DNA of the most atypical nevi from a group of melanoma cases by laser-captured microdissection and screened the coding region (exons 1 and 2) of CDKN2A for point mutations. This study, which was a component of a larger case-control study of melanocytic nevus attributes in patients with melanoma, used spouses as matched controls. In doing so, we further tested the hypothesis that nevi constitute proximal stages in melanocytic tumor progression and that CDKN2A is centrally involved in the initiation of melanoma.

PREPARATION OF PARAFFIN-EMBEDDED TISSUE SECTIONS

Melanocytic nevi were collected from a series of patients with melanoma and matched spouse controls under a protocol approved by the University of Washington (Seattle) institutional review board. The patient population for entry into the study consisted of persons 18 years or older recently diagnosed as having melanoma, who were referred to the University of Washington Cancer Center for treatment and who had spouses willing to participate in the study.Complete skin examination identified the largest and most atypical nevus with a macular component for biopsy sampling from each case and control; although the most atypical nevus was selected, in some instances the lesions were not especially atypical. Ten case/control pairs were randomly culled from the source database of 87 matched pairs for the present analysis. The histological ratings of these nevi for microscopical criteria of melanocytic dysplasia are given in the Table.

Table Graphic Jump LocationTable. Histological Classification of the Melanocytic Nevi Analyzed for CDKN2A Genotype*

The biopsy tissues were fixed in formalin and embedded in paraffin. Tissue sections of 10 μm were mounted on glass slides with polyethylene naphtholate (PEN) membranes (Carl Zeiss Inc, Thornwood, NY). The PEN membranes were attached to slides wetted with 70% ethanol and were fixed in place using Fixogum rubber cement. Before staining, the mounted sections were dried overnight at 40°C. The paraffin was removed with xylene, and the sections were stained with hematoxylin using standard methods in preparation for laser-captured microdissection.

LASER-CAPTURED MICRODISSECTION AND DNA EXTRACTION

The PALM (positioning and ablation with the laser microbeam) system (PALM Microlaser AG, Bernried, Germany) was used for microdissection of nevus-specific tissues. The dissected tissue fragments, which consisted of approximately 500 nuclei, were collected in 0.5-mL Eppendorf microfuge tubes. Then, 50 μL of 2 × magnesium-free polymerase chain reaction (PCR) buffer with 0.04% proteinase K was added to each tube. The samples were incubated at 37°C overnight. Heating the samples at 95°C for 6 minutes denatured the proteinase K.The samples were then kept at 4°C until used for PCR analyses.

PCR ANALYSES OF p16 ALLELES

Nested PCR was used to amplify exons 1 and 2 of the p16 gene. Primers HW1F, HW1R, HW2F, and HW2R were designed based on the published DNA sequence (GenBank Accession Nos. U12818 and U12819 for exons 1 and 2, respectively; National Center for Biotechnology Information [NCBI], Bethesda, Md). Primers X59F, X284R, X78F, and X482R were previously described.17 The following primers were used in the first and second round of PCR reactions to amplify exon 1:

  • First round:

  • HW1F (5′ CTGGCTGGTCACCAGAGGGTG 3′)

  • HW1R (5′ CCAATTCCCCTGCAAACTTCG 3′)

  • Second round:

  • X59F (5′ CGGCTGCGGAGAGGGGGAGAG 3′)

  • X284R (5′ CTCCAGAGTCGCCCGCCATCC 3′)

The following primers were used in the first and second round of PCR reactions to amplify exon 2:

  • First round:

  • X78F (5′ GGGCTCTACACAAGCTTCCTT 3′)

  • HW2R (5′ TCTGTGCTGGAAAATGAATGCTC 3′)

  • Second round:

  • HW2F (5′ CCACCCTGGCTCTGACCATTC 3′)

  • X482R (5′ TTTGGAAGCTCTCAGGGTACA 3′)

The locations of all primers in the CDKN2A gene are shown in Figure 1. We did not analyze exon 3 because it encodes only 3 amino acids at the carboxyl terminus. The Expand High Fidelity PCR System (Roche Diagnostics, Indianapolis, Ind) was used for all PCR reactions. Using 10 μL of each sample from the laser-capture microdissection, the PCR reactions were carried out with 3 cycles at 95°C for 1 minute, 65°C for 1 minute, and 72°C for 1 minute, followed by 40 cycles at 95°C for 30 seconds, 64°C for 30 seconds, and 72°C for 45 seconds. The reaction mixture from the first round of PCR was purified with the Microcon spin columns (Millipore, Burlington, Mass). One tenth of the purified product was used for the second round reaction.

Place holder to copy figure label and caption
Figure 1.

Forward and reverse primers for amplification of exonic 1 and 2 sequences of the CDKN2A gene from the melanoma case and control nevi.

Graphic Jump Location
SEQUENCING OF PCR PRODUCTS

The reaction mixtures were purified with the Microcon columns and examined by 2% agarose gel electrophoresis prior to the sequencing reactions. Once the presence of the PCR products was confirmed by gel electrophoresis, the PCR products were labeled using the Big Dye Sequencing Kit (Applied Biosystems, Foster City, Calif) for sequencing. The PCR products were sequenced from both 5′ and 3′ ends to ensure the fidelity of the sequence data.

The nuclei for mutational analysis of the p16 gene were obtained from the cells of melanocytic nevi by laser-captured microdissection, as described in the “Methods” section. Figure 2 depicts the histological appearance of a nevus before and after microdissection of its nuclei. Exons 1 and 2 and neighboring intronic regions of the amplified gene from each case and control sample were amplified using pairs of forward and reverse primers via a nested approach (Figure 1). An example of one experiment using laser-captured nevi is shown in Figure 3. All PCR pairs used for first and second (nested) PCR studies gave amplification products of the predicted size (data not shown).

Place holder to copy figure label and caption
Figure 2.

Histological appearance of a nevus before (A) and after (B) microdissection of its nuclei.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

Exonic 1 and 2 (E1 and E2) fragments from the nested polymerase chain reactions. MW indicates molecular weight. Code numbers 2498493 and 2598404 corresponding to lanes 3, 6 and 4, 7, respectively, refer to the amplified exonic fragments obtained from samples of 2 separate nevus specimens.

Graphic Jump Location

The sequences for exons 1 and 2 obtained from nested PCR amplification of the 10 pairs of melanoma cases and spouse controls were aligned with the published genomic sequences of p16 (see “Methods” section) by use of the NCBI Blast program. No sequence mutations were identified in any of the atypical nevi or normal control tissue samples.

The failure to find any CDKN2A coding sequence mutations within this series of 20 atypical nevi indicates that point mutations or small deletions must be quite uncommon in the melanocytic cells of those lesions (ie,<5% prevalence). A caveat is that the study design would not have detected large hemizygous deletions involving one of the CDKN2A alleles, if such genetic alterations had been present. Nonetheless, our data suggest that mutations in genes other than CDKN2A are more centrally involved in the genesis of common nevi and their atypical variants.

Although atypical (dysplastic) nevi are much more prevalent than melanomas, and they are in most instances stable lesions, it is nevertheless thought that they may occasionally progress to melanoma.1,2,18 This hypothesis derives from such evidence as serial photographic examination of individual nevi and from the frequent spatial proximity of nevus remnants and melanoma within histological sections.1,19 Remnants of nevi in sections of melanoma are reportedly found at a frequency of approximately 10% to greater than 30%, and the association is not a random event, suggesting a precursor-product relationship.20 In a study of thin melanomas, histological evidence of an associated nevus was found in 51% of cases, and of these, 56% were atypical nevi and 41% were banal nevi.21

The hypothesis that atypical nevi are potential precursors to melanoma predicts that nevi could incur genetic alterations essential to the initiation and/or progression of melanoma. In some studies of DNA ploidy, the atypical nevus cells more frequently contained hyperdiploid DNA content than did banal nevi,22,23 but they were not characterized by the aneuploidy that is typical of melanoma.23 Other studies have failed to find abnormal DNA content in atypical nevi.24,25 In another experimental strategy, the tumor antigen profile of atypical nevus cells was determined to be intermediate between that of common nevus cells and melanoma, such that the expression levels of the tumor-related antigens, epidermal growth factor and nerve growth factor receptors, increased progressively from melanocytes, banal nevus cells, atypical nevus cells, radial growth phase melanoma, vertical growth phase melanoma, and metastatic melanoma.26

Taken together with other lines of evidence,3,69 the present data support the hypothesis that acquired or germ-line sequence variations in the coding or enhancing/promoting regions of the CDKN2A (p16) gene are not the major genetic determinants of the atypical nevus phenotype. This is not to say, however, that nevi do not share in genetic lesions at loci involved more distally in tumor progression. In this regard, recent interest has come to be focused on BRAF, a proto-oncogene functioning in the ras pathway of cell proliferation control. Initial and confirmatory reports have described activating mutations in the coding region of that gene within melanocytic nevi, as well as within melanoma cells, at a sufficiently high frequency to indicate a common role in melanocytic tumor progression.2730 Kumar et al30 also reported activating ras mutations in several nevi, some in association with BRAF mutations, further implicating the ras/BRAF pathway in early genetic events that lead to melanoma. It is reasonable to expect that future molecular studies will identify additional genetic elements targeted for activating or deactivating mutations in both nevus and melanoma cells that could reflect shared pathways in oncogenic development, thus providing further insight into the molecular mechanisms of transformation and progression in melanocytes.

Correspondence: Michael Piepkorn, MD, PhD, Division of Dermatology, Box 356524, University of Washington, Seattle, WA 98195 (mpiepkor@u.washington.edu).

Accepted for Publication: November 7, 2004.

Funding/Support: Dr Wang was supported by Dermatology Training Grant T32 AR07019 from the National Institutes of Health, Bethesda, Md, and by the Carl J. Herzog Foundation, Stamford, Conn.

Acknowledgment: We acknowledge the members of the North American Melanoma Pathology Study Group for their review and classification of the melanocytic nevi used in the analyses.

Financial Disclosure: None.

Clark  WH  JrElder  DEGuerry  DEpstein  MNGreene  MHvan Horn  M A study of tumor progression: the precursor lesions of superficial spreading and nodular melanoma Hum Pathol 1984;151147- 1165
PubMed
Piepkorn  M Melanoma genetics: an update with focus on the CDKN2A(p16)/ARF tumor suppressors J Am Acad Dermatol 2000;42705- 722
PubMed
Keller-Melchior  RSchmidt  RPiepkorn  M Expression of the tumor suppressor gene product p16INK4 in benign and malignant melanocytic lesions J Invest Dermatol 1998;110932- 938
PubMed
Grover  RChana  JSWilson  GDRichman  PISamders  R An analysis of p16 protein expression in sporadic malignant melanoma Melanoma Res 1998;8267- 272
PubMed
Sparrow  LEEldon  MJEnglish  DRHeenan  PJ p16 and p21 WAF1 protein expression in melanocytic tumors by immunohistochemistry Am J Dermatopathol 1998;20255- 261
PubMed
Puig  SRuiz  ACastel  T  et al.  Inherited susceptibility to several cancers but absence of linkage between dysplastic nevus syndrome and CDKN2A in a melanoma family with a mutation in the CDKN2A (P16INK4A) gene Hum Genet 1997;101359- 364
PubMed
Barrett  JHGaut  RWachsmuth  RNewton Bishop  JABishop  T Linkage and association analysis of nevus density and the region containing the melanoma gene CDKN2A in UK twins Br J Cancer 2003;881920- 1924
PubMed
Welch  JMillar  DGoldman  A  et al.  Lack of genetic and epigenetic changes in CDKN2A in melanocytic nevi J Invest Dermatol 2001;117383- 384
PubMed
Papp  TPemsel  HRollwitz  I  et al.  Mutational analysis of N-ras, p53, CDKN2A (p16INK4a), p14ARF, CDK4, and MC1R genes in human dysplastic melanocytic nevi J Med Genet 2003;40e14
PubMed
Park  WSVortmeyer  AOPack  S  et al.  Allelic deletion at chromosome 9p21(p16) and 17p13(p53) in microdissected sporadic dysplastic nevus Hum Pathol 1998;29127- 130
PubMed
Boni  RZhuang  ZAlbuquergue  AVortmeyer  ADuray  P Loss of heterozygosity detected on 1p and 9qin microdissected atypical nevi Arch Dermatol 1998;134882- 883
PubMed
Birindelli  STragni  GBartoli  C  et al.  Detection of microsatellite alterations in the spectrum of melanocytic nevi in patients with or without individual or family history of melanoma Int J Cancer 2000;86255- 261
PubMed
Tran  TPTitus-Ernstoff  LPerry  AEErnstoff  MSNewsham  IF Alteration of chromosome 9p21 and/or p16 in benign and dysplastic nevi suggests a role in early melanoma progression (United States) Cancer Causes Control 2002;13675- 682
PubMed
Bogdan  ISmolle  JKerl  HBurg  GBoni  R Melanoma ex naevo: a study of the associated naevus Melanoma Res 2003;13213- 217
PubMed
Korabiowska  MBrinck  URuschenburg  IDengler  HDroese  MBerger  H Expression of DNA mismatch repair genes in naevi In Vivo 1999;13251- 254
PubMed
Hussein  MRSun  MTuthill  RJ  et al.  Comprehensive analysis of 112 melanocytic skin lesions demonstrates microsatellite instability in melanomas and dysplastic nevi, but not in benign nevi J Cutan Pathol 2001;28343- 350
PubMed
Kumar  RLundh Rozell  BLouhelainen  JHemminki  K Mutations in the CDKN2A (p16INK4a) gene in microdissected sporadic primary melanomas Int J Cancer 1998;75193- 198
PubMed
Seykora  JElder  D Dysplastic nevi and other risk markers for melanoma Semin Oncol 1996;23682- 687
PubMed
Greene  MHClark  WH  JrTucker  MA  et al.  Acquired precursors of cutaneous malignant melanoma: the familial dysplastic nevus syndrome N Engl J Med 1985;31291- 97
PubMed
Smolle  JKaddu  SKerl  H Non-random spatial association of melanoma and nevi—a morphometric analysis Melanoma Res 1999;9407- 412
PubMed
Skender-Kalnenas  TMEnglish  DRHeenan  PJ Benign melanocytic lesions: risk markers or precursors of cutaneous melanoma J Am Acad Dermatol 1995;331000- 1007
PubMed
Bergman  WRuiter  DJScheffer  Evan Vloten  WA Melanocytic atypia in dysplastic nevi: immunohistochemical and cytophotometrical analysis Cancer 1988;611660- 1666
PubMed
Fleming  MGWied  GLDytch  HE Image analysis cytometry of dysplastic nevi J Invest Dermatol 1990;95287- 291
PubMed
Sangueza  OPHyder  DMBakke  ACWhite  CR  Jr DNA determination in dysplastic nevi: a comparative study between flow cytometry and image analysis Am J Dermatopathol 1993;1599- 105
PubMed
Bjornhagen  VBonfoco  EBrahme  EMLindholm  JAuer  G Morphometric, DNA, and proliferating cell nuclear antigen measurements in benign melanocytic lesions and cutaneous malignant melanoma Am J Dermatopathol 1994;16615- 623
PubMed
Elder  DERodeck  UThurin  J  et al.  Antigenic profile of tumor progression stages in human melanocytic nevi and melanomas Cancer Res 1989;495091- 5096
PubMed
Yazdi  ASPalmedo  GFlaig  MJ  et al.  Mutations of the BRAF gene in benign and malignant melanocytic lesions J Invest Dermatol 2003;1211160- 1162
PubMed
Arbiser  JL Activation of B-raf in non-malignant nevi predicts a novel tumor suppressor gene in melanoma (MAP kinase phosphatase) J Invest Dermatol 2003;121xiv
PubMed
Uribe  PWistuba  IIGonzalez  S BRAF mutation: a frequent event in benign, atypical, and malignant melanocytic lesions of the skin Am J Dermatopathol 2003;25365- 370
PubMed
Kumar  RAngelini  SSnellman  EHemminki  K BRAF mutations are common somatic events in melanocytic nevi J Invest Dermatol 2004;122342- 348
PubMed

Figures

Place holder to copy figure label and caption
Figure 1.

Forward and reverse primers for amplification of exonic 1 and 2 sequences of the CDKN2A gene from the melanoma case and control nevi.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Histological appearance of a nevus before (A) and after (B) microdissection of its nuclei.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

Exonic 1 and 2 (E1 and E2) fragments from the nested polymerase chain reactions. MW indicates molecular weight. Code numbers 2498493 and 2598404 corresponding to lanes 3, 6 and 4, 7, respectively, refer to the amplified exonic fragments obtained from samples of 2 separate nevus specimens.

Graphic Jump Location

Tables

Table Graphic Jump LocationTable. Histological Classification of the Melanocytic Nevi Analyzed for CDKN2A Genotype*

References

Clark  WH  JrElder  DEGuerry  DEpstein  MNGreene  MHvan Horn  M A study of tumor progression: the precursor lesions of superficial spreading and nodular melanoma Hum Pathol 1984;151147- 1165
PubMed
Piepkorn  M Melanoma genetics: an update with focus on the CDKN2A(p16)/ARF tumor suppressors J Am Acad Dermatol 2000;42705- 722
PubMed
Keller-Melchior  RSchmidt  RPiepkorn  M Expression of the tumor suppressor gene product p16INK4 in benign and malignant melanocytic lesions J Invest Dermatol 1998;110932- 938
PubMed
Grover  RChana  JSWilson  GDRichman  PISamders  R An analysis of p16 protein expression in sporadic malignant melanoma Melanoma Res 1998;8267- 272
PubMed
Sparrow  LEEldon  MJEnglish  DRHeenan  PJ p16 and p21 WAF1 protein expression in melanocytic tumors by immunohistochemistry Am J Dermatopathol 1998;20255- 261
PubMed
Puig  SRuiz  ACastel  T  et al.  Inherited susceptibility to several cancers but absence of linkage between dysplastic nevus syndrome and CDKN2A in a melanoma family with a mutation in the CDKN2A (P16INK4A) gene Hum Genet 1997;101359- 364
PubMed
Barrett  JHGaut  RWachsmuth  RNewton Bishop  JABishop  T Linkage and association analysis of nevus density and the region containing the melanoma gene CDKN2A in UK twins Br J Cancer 2003;881920- 1924
PubMed
Welch  JMillar  DGoldman  A  et al.  Lack of genetic and epigenetic changes in CDKN2A in melanocytic nevi J Invest Dermatol 2001;117383- 384
PubMed
Papp  TPemsel  HRollwitz  I  et al.  Mutational analysis of N-ras, p53, CDKN2A (p16INK4a), p14ARF, CDK4, and MC1R genes in human dysplastic melanocytic nevi J Med Genet 2003;40e14
PubMed
Park  WSVortmeyer  AOPack  S  et al.  Allelic deletion at chromosome 9p21(p16) and 17p13(p53) in microdissected sporadic dysplastic nevus Hum Pathol 1998;29127- 130
PubMed
Boni  RZhuang  ZAlbuquergue  AVortmeyer  ADuray  P Loss of heterozygosity detected on 1p and 9qin microdissected atypical nevi Arch Dermatol 1998;134882- 883
PubMed
Birindelli  STragni  GBartoli  C  et al.  Detection of microsatellite alterations in the spectrum of melanocytic nevi in patients with or without individual or family history of melanoma Int J Cancer 2000;86255- 261
PubMed
Tran  TPTitus-Ernstoff  LPerry  AEErnstoff  MSNewsham  IF Alteration of chromosome 9p21 and/or p16 in benign and dysplastic nevi suggests a role in early melanoma progression (United States) Cancer Causes Control 2002;13675- 682
PubMed
Bogdan  ISmolle  JKerl  HBurg  GBoni  R Melanoma ex naevo: a study of the associated naevus Melanoma Res 2003;13213- 217
PubMed
Korabiowska  MBrinck  URuschenburg  IDengler  HDroese  MBerger  H Expression of DNA mismatch repair genes in naevi In Vivo 1999;13251- 254
PubMed
Hussein  MRSun  MTuthill  RJ  et al.  Comprehensive analysis of 112 melanocytic skin lesions demonstrates microsatellite instability in melanomas and dysplastic nevi, but not in benign nevi J Cutan Pathol 2001;28343- 350
PubMed
Kumar  RLundh Rozell  BLouhelainen  JHemminki  K Mutations in the CDKN2A (p16INK4a) gene in microdissected sporadic primary melanomas Int J Cancer 1998;75193- 198
PubMed
Seykora  JElder  D Dysplastic nevi and other risk markers for melanoma Semin Oncol 1996;23682- 687
PubMed
Greene  MHClark  WH  JrTucker  MA  et al.  Acquired precursors of cutaneous malignant melanoma: the familial dysplastic nevus syndrome N Engl J Med 1985;31291- 97
PubMed
Smolle  JKaddu  SKerl  H Non-random spatial association of melanoma and nevi—a morphometric analysis Melanoma Res 1999;9407- 412
PubMed
Skender-Kalnenas  TMEnglish  DRHeenan  PJ Benign melanocytic lesions: risk markers or precursors of cutaneous melanoma J Am Acad Dermatol 1995;331000- 1007
PubMed
Bergman  WRuiter  DJScheffer  Evan Vloten  WA Melanocytic atypia in dysplastic nevi: immunohistochemical and cytophotometrical analysis Cancer 1988;611660- 1666
PubMed
Fleming  MGWied  GLDytch  HE Image analysis cytometry of dysplastic nevi J Invest Dermatol 1990;95287- 291
PubMed
Sangueza  OPHyder  DMBakke  ACWhite  CR  Jr DNA determination in dysplastic nevi: a comparative study between flow cytometry and image analysis Am J Dermatopathol 1993;1599- 105
PubMed
Bjornhagen  VBonfoco  EBrahme  EMLindholm  JAuer  G Morphometric, DNA, and proliferating cell nuclear antigen measurements in benign melanocytic lesions and cutaneous malignant melanoma Am J Dermatopathol 1994;16615- 623
PubMed
Elder  DERodeck  UThurin  J  et al.  Antigenic profile of tumor progression stages in human melanocytic nevi and melanomas Cancer Res 1989;495091- 5096
PubMed
Yazdi  ASPalmedo  GFlaig  MJ  et al.  Mutations of the BRAF gene in benign and malignant melanocytic lesions J Invest Dermatol 2003;1211160- 1162
PubMed
Arbiser  JL Activation of B-raf in non-malignant nevi predicts a novel tumor suppressor gene in melanoma (MAP kinase phosphatase) J Invest Dermatol 2003;121xiv
PubMed
Uribe  PWistuba  IIGonzalez  S BRAF mutation: a frequent event in benign, atypical, and malignant melanocytic lesions of the skin Am J Dermatopathol 2003;25365- 370
PubMed
Kumar  RAngelini  SSnellman  EHemminki  K BRAF mutations are common somatic events in melanocytic nevi J Invest Dermatol 2004;122342- 348
PubMed

Correspondence

CME


You need to register in order to view this quiz.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s "Cited By" API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Comment

Multimedia

Some tools below are only available to our subscribers or users with an online account.

Related Content

Customize your page view by dragging & repositioning the boxes below.

See Also...
Articles Related By Topic
Related Topics
PubMed Articles